Protocols:RNAseq
From FANTOM5_SSTAR
Sequencing libraries was constructed starting from 2 μg of total RNA. rRNA removal step is executed by (Dynabeads Oligo(dT)25 treatment or Ribo-Zero treatment) [1]. If rRNA removal step is unnecessary, proceed to RNA fragmentation process.
rRNA removed RNA is fragmented by heating at 70°C for 3.5 min with 1 μl fragmentation buffer (Ambion) and immediately kept on ice. Add 1 μl of Stop solution. Fragmented RNA is purified with the RNeasy MinElute kit (Qiagen) following the instructions of the manufacturer [3] except 675 μl of 100% ethanol is used in step two. Purified RNA is dephosphorylated by adding 2 μl of 10× phosphatase buffer, 5 U of Antarctic phosphatase (NEB) and 40 U of RNaseOut (invitrogen) and incubating at 37°C for 30 min followed by 5 min at 65°C. After incubation, set sample on ice and following add reagents; 5 μl of 10× PNK buffer, 20 U of T4 polynucleotide kinase (NEB), 5 μl of 10 mM ATP (Epicentre), 40 U of RNaseOut, 17 μl of water. Incubate at 37°C for 60 min. Phosphorated RNA is purified with the RNeasy MinElute kit (Qiagen) as described before. Purified RNA is concentrated to 6 μl by miVac DNA concentrator (Genevac). Mix 1 μl of 2 μM pre-adenylated 3’ DNA adaptor [4] to concentrated RNA. Incubate at 70°C for 2 min and immediately kept on ice for 2 min. Add 1 µl of 10× T4 RNA ligase 2 truncated buffer, 0.8 µl of 100 mM MgCl2, 20U of RNaseOUT and 200U of RNA ligase 2 truncated (NEB). Incubate at 20°C for 60 min. 1 µl of heat-denatured 5 µM 5’ RNA adapter [5] is ligated with 3’ adapter ligation products with 20 U of T4 RNA ligase 1 (NEB) and 1 µl of 10 mM ATP (NEB) at 20°C for 60 min. Mix 4 μl of adaptor-ligated RNA with 1 μl of 20 µM RT Primer [6], followed by incubation at 70°C for 2 min, and immediately kept on ice. Add 2 μl 5×Prime Script buffer, 1 µl of 10 mM dNTP, 20U of RNaseOUT and 200 U of PrimeScript Reverse Transcriptase (Takara). Incubate at 44°C for 30 min. The whole cDNA product is amplified by PCR with 10 µl of 5× HF buffer, 1.25 µl of 10 mM each dNTP mix, 2 µl of 10 µM FWD primer [7], 2 µl of REV primer [6] and 1 U of Phusion High-Fidelity DNA Polymerase (NEB). PCR is carried out in a total of 50 µl. After incubation at 98°C for 30 sec, [number_of_PCR_cycles] [8] PCR cycles were performed for 10 sec at 98°C, and 30 sec at 60°C, and 15 sec at 72°C. Finally the sample is incubated at 72°C for 5 min and kept at 4°C. Remove PCR primers using 1.2 volumes of AMPure XP beads (Beckman). This step was repeated two times. Check library size and concentration by High-Sensitivity DNA Kit (Agilent). Library can be sequenced Illumina Genome Analyzer II or HiSeq2000 using custom sequencing primer [9].
References/Notes
[1] rRNA_removal_method
Dynabeads Oligo(dT)25 treatment:
Poly(A)+ RNA are isolated using Dynabeads Oligo(dT)25 (Invitrogen) according to the manufacturer’s protocol. This isolation step is repeated two times. Final elution volume is 20μl.
File:Note1 2008729133616244.pdf
Ribo-Zero treatment:
rRNA are removed using Ribo-Zero™ rRNA removal Kit (epicentre) according to the manufacturer’s protocol. Final elution volume is 20 μl.
[3] File:RNeasy MinElute Cleanup Handbook.pdf
[4] pre-adenylated 3’ DNA adaptor ; App/ATCTCGTATGCCGTCTTCTGCTTG/3' idT
[5] 5’ RNA adapter ; guucagaguucuacaguccgacgaucgaaa
[6] RT Primer/ REV primer; CAAGCAGAAGACGGCATACGA
[7] FWD primer; AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
[8] 12 PCR cycle for normal condition.
[9] sequencing primer; CGACAGGTTCAGAGTTCTACAGTCCGACGATCGAAA
